Supplementary Table : Primers used for real-time pcr experiments

Supplement

Supplementary Table : Primers used for real-time PCR experiments.

gene	full gene name	Assay name or sequence
BTC	betacellulin	Hs_BTC_1_SG
EGFR	epidermal growth factor receptor	Hs_EGFR_vb.1_SG
WNT2B	wingless-type MMTV integration site family, member 2B	Hs_WNT2B_va.1_SG
SULT4A1	sulfotransferase family 4A, member 1	Hs_SULT4A1_1_SG
ABCB1	ABC-Transporter B1 (P-glycoprotein)	Hs_ABCB1_1_SG
PIK3R5	phosphoinositide-3-kinase, regulatory subunit 5	HS_PIK3R5_1_SG
CYP3A43	cytochrome P450 3A43	HS_CYP3A43_1_SG
HBEGF	heparin-binding EGF-like growth factor	HS_HBEGF_1_SG
TCF7L2	transcription factor 7-like 2	Hs_TCF7L2_1_SG
ERBB3	epidermal growth factor receptor 3	Hs_ERBB3_vb.1_SG
FZD7	frizzled homolog 7	Fwd: CCTTCCCCTTCTCATGCCC Rev: CAGCCCGACAGGAAGATGAT
MAPK9	mitogen-activated protein kinase 9	Hs_MAPK9_va.1_SG
PRKCA	protein kinase C, alpha	Hs_PRKCA_1_SG
TCF7	transcription factor 7	Hs_TCF7_va.1_SG
CACNA2D3	calcium channel, voltage-dependent, alpha 2/delta subunit 3	Hs_CACNA2D3_1_SG
GAPDH	Glyceraldehyde 3-phosphate dehydrogenase	Hs_CACNA2D3_1_SG

Supplementary Figure 1: Clinical data of microarray cell lines



Abbreviations: TCA (tricyclic antidepressants), SSRI (selective serotonin reuptake inhibitors), SNRI (serotonin-norepinephrine reuptake inhibitors), NASSA (noradrenergic and specific serotonergic antidepressant), NARI (noradrenalin-reuptake-inhibitor), BZD (benzodiazepines), SLP (sleep medication)
Supplementary Table 2: Clinical Data Overview



Abbreviations: f (female), m (male), TCA (tricyclic antidepressants), SSRI (selective serotonin reuptake inhibitors), SNRI (serotonin-norepinephrine reuptake inhibitors), NASSA (noradrenergic and specific serotonergic antidepressant), NARI (noradrenalin-reuptake-inhibitor), SSRE (selective serotonin reuptake enhancer)

Supplementary Table 3: Microarray results (fold changes) of identified genes being involved GO terms of brain remodeling processes. Mean values and standard deviations (sd) of responder (R) and non-responder (NR) derived cell lines are indicated as well as p-values calculated by Wilcoxon-Mann-Whitney rank-sum test. Significant p-values are in bold.

genes		cell lines										mean (sd)
ProbeName	Symbol	1WXV	2411	24DC	275J	275U	278D	278H	278S	96	CY24	R			NR			p-value
A_24_P282416	ABL1	-1,1	-1,2	-1,5	-2,5	-2,1	1,1	-1,3	1,2	-1,9	1,0	-0,8	±	1,6	-0,9	±	1,3	1,00
A_23_P135769	ACTB	1,1	-1,5	2,1	2,3	5,0	2,1	-1,0	-1,3	-1,7	-2,0	1,9	±	2,0	-1,6	±	0,4	0,02
A_23_P105957	ACTN1	-1,1	-1,5	-2,1	-2,4	-1,1	1,4	-1,3	-1,3	-2,4	-2,0	-1,1	±	1,3	-1,8	±	0,5	0,35
A_23_P101655	ACTN4	-1,2	-1,8	-2,2	-3,0	1,2	1,6	-1,6	-1,3	-2,7	-2,2	-0,8	±	1,9	-2,1	±	0,5	0,26
A_33_P3408983	APC	-1,2	1,4	2,5	4,4	1,7	1,2	1,7	1,7	2,4	1,4	1,7	±	1,8	1,7	±	0,5	1,00
A_23_P73511	ARAF	1,0	-1,0	-2,0	-2,6	-1,1	1,4	-1,6	-1,4	-2,2	-1,6	-0,8	±	1,6	-1,6	±	0,5	0,61
A_24_P298027	AXIN2	4,2	1,2	2,6	1,7	1,2	1,1	-1,3	-1,1	-1,9	1,1	1,6	±	1,7	-0,2	±	1,6	0,11
A_23_P148015	AXIN2	1,2	1,1	1,0	-1,6	-5,8	-3,4	1,1	-1,1	-1,0	1,4	-1,6	±	2,7	0,6	±	1,1	0,11
A_33_P3398526	BCL2L11	-1,1	-1,2	1,5	3,0	2,6	-1,1	1,1	-1,3	-1,4	-1,1	0,6	±	2,0	-0,6	±	1,2	0,11
A_33_P3251932	BCL2L11	-1,2	-1,6	-2,1	-1,7	-1,7	-1,3	-1,2	-1,4	-2,0	-1,6	-1,6	±	0,3	-1,6	±	0,3	0,26
A_23_P135722	BTC	1,8	-1,1	107,1	103,2	30,6	-1,1	2,1	-1,9	-1,0	-1,3	40,0	±	52,0	-0,3	±	1,6	0,91
A_23_P373031	CACNA1C	-1,1	-1,4	2,7	4,2	2,1	1,1	-1,0	-1,4	-1,3	-1,5	1,3	±	2,2	-1,3	±	0,2	0,35
A_33_P3297580	CACNA1C	4,6	-1,1	-2,1	1,0	-4,0	-2,6	-4,3	1,2	1,2	-1,5	-0,3	±	3,2	-1,4	±	2,2	0,07
A_33_P3825869	CACNA1C	-7,1	-1,0	-3,0	1,4	-3,8	-1,9	1,3	1,2	-5,4	1,2	-2,2	±	3,2	-1,0	±	3,1	0,76
A_23_P365767	CACNA1D	-1,2	1,6	-1,1	2,2	3,6	-1,2	1,1	1,1	-2,2	-2,0	0,6	±	2,1	-0,4	±	2,0	0,61
A_23_P148327	CACNA1F	1,0	1,0	1,3	-1,1	-6,4	-1,5	1,0	-1,1	-1,6	1,6	-1,3	±	2,8	0,5	±	1,5	0,35
A_23_P85765	CACNA1S	1,1	-1,2	-4,1	-2,4	-1,6	-1,1	-1,4	-1,3	1,0	1,1	-1,6	±	1,7	-0,1	±	1,4	0,48
A_24_P91165	CACNB1	-1,2	1,3	1,5	2,9	3,0	1,1	-1,2	-1,1	-1,8	-1,3	1,0	±	1,8	-0,7	±	1,4	0,26
A_33_P3285277	CACNB2	1,5	-2,3	-1,1	3,9	2,8	-1,0	-1,1	1,1	1,4	-1,1	1,2	±	2,0	-0,8	±	1,5	0,07
A_33_P3363271	CACNB2	1,2	1,0	-1,1	-2,3	-2,8	-1,2	-1,3	1,2	1,3	-1,3	-0,8	±	1,7	-0,1	±	1,4	0,11
A_33_P3221989	CACNB4	1,1	1,4	1,1	1,7	-2,1	-1,2	-1,0	1,4	2,3	3,8	0,3	±	1,6	1,6	±	2,0	0,76
A_23_P300056	CDC42	1,2	1,1	-1,8	-3,1	-2,2	-1,5	-1,0	1,3	1,5	1,0	-1,0	±	1,8	0,6	±	1,1	0,17
A_24_P81841	CDKN1B	-1,1	1,4	-1,2	-1,7	-2,2	-1,1	1,3	1,3	2,2	1,9	-1,0	±	1,2	1,7	±	0,4	0,26
A_24_P270814	CRK	1,1	-1,1	-2,5	-4,7	-3,6	1,6	-1,3	-1,2	-1,8	-1,4	-1,5	±	2,5	-1,4	±	0,3